1:2415197 _ / CCCGTGTGGGGGGCGTTGACT


Site Quality
3582.73
Filter Status
PASS
Note: These are site-level quality metrics: they may be unpredictable for multi-allelic sites.

Population Frequencies
Population Allele Count Allele Number Number of Homozygotes Number of Heterozygotes Homozygous Genotype Freq. Heterozygous Genotype Freq. Allele Frequency
Arab 0 204 0 0 0.0 0.0 0
Azeri 4 200 2 0 0.02 0.0 0.02
Baloch 10 202 5 0 0.0495 0.0 0.0495
Gilaki 0 198 0 0 0.0 0.0 0
Kurd 6 200 3 0 0.03 0.0 0.03
Lur 0 200 0 0 0.0 0.0 0
Mazani 8 200 4 0 0.04 0.0 0.04
Persian 0 200 0 0 0.0 0.0 0
Persian Gulf Islander 0 200 0 0 0.0 0.0 0
Sistani 0 200 0 0 0.0 0.0 0
Turkmen 0 200 0 0 0.0 0.0 0
Zartoshti 8 200 4 0 0.04 0.0 0.04
Total 36 2404 18 0 0.014975041597337771 0.0 0.01498
Annotations

This variant falls on 7 transcripts in 1 genes:

Note: This list may not include additional transcripts in the same gene that the variant does not overlap.

Additional Annotations
Metric Prediction
SIFT Pred (C) ?
Polyphen2 HVAR Pred (C) ?
MutationTaster Pred (C) ?
MutationAssessor Pred (C) ?
FATHMM Pred (C) ?
FATHMM MKL Coding Pred (C) ?
N of 6 Predicted Damaging ?
N of 6 Predicted Tolerated ?
MetaSVM Pred ?
MetaLR Pred ?
GERP++ RS ?
CADD Score (Phred Scale) 4.151
Ada Score ?
RF Score ?
PDIVAS Score ?
ConSplice Score ?
REVEL Score ?

Quality Metrics

Note: Plot may include low-quality genotypes that were excluded from allele counts in the table above