1:2426429 GTGTCCTCCCTGCTCCCAGTGCCCC / _

dbSNP
rs774037572
Allele Frequency
0.01705
Allele Count
41 / 2404
UCSC
1-2426429-GTGTCCTCCCTGCTCCCAGTGCCCC-_
ClinVar
Click to search for variant in Clinvar
Ensembl
Click to search for variant in Ensembl
gnomAD Browser
Click to search for variant in gnomAD Browser
Site Quality
7638.81
Filter Status
PASS
 Note: These are site-level quality metrics: they may be unpredictable for multi-allelic sites.
Population Frequencies
Population Allele Count Allele Number Number of Homozygotes Number of Heterozygotes Homozygous Genotype Freq. Heterozygous Genotype Freq. Allele Frequency
Arab 3 204 0 3 0.0 0.0294 0.01471
Azeri 4 200 0 4 0.0 0.04 0.02
Baloch 4 202 0 4 0.0 0.0396 0.0198
Gilaki 1 198 0 1 0.0 0.0101 0.005051
Kurd 5 200 0 5 0.0 0.05 0.025
Lur 3 200 1 1 0.01 0.01 0.015
Mazani 1 200 0 1 0.0 0.01 0.005
Persian 3 200 0 3 0.0 0.03 0.015
Persian Gulf Islander 3 200 0 3 0.0 0.03 0.015
Sistani 11 200 1 9 0.01 0.09 0.055
Turkmen 0 200 0 0 0.0 0.0 0
Zartoshti 3 200 0 3 0.0 0.03 0.015
Total 41 2404 2 37 0.0016638935108153079 0.030782029950083195 0.01705
Annotations

This variant falls on 7 transcripts in 1 genes:

Note: This list may not include additional transcripts in the same gene that the variant does not overlap.

Additional Annotations
Metric Prediction
SIFT Pred (C) ?
Polyphen2 HVAR Pred (C) ?
MutationTaster Pred (C) ?
MutationAssessor Pred (C) ?
FATHMM Pred (C) ?
FATHMM MKL Coding Pred (C) ?
N of 6 Predicted Damaging ?
N of 6 Predicted Tolerated ?
MetaSVM Pred ?
MetaLR Pred ?
GERP++ RS ?
CADD Score (Phred Scale) 4.805
Ada Score ?
RF Score ?
PDIVAS Score ?
ConSplice Score ?
REVEL Score ?

Quality Metrics

Note: Plot may include low-quality genotypes that were excluded from allele counts in the table above