1:2426429 GTGTCCTCCCTGCTCCCAGTGCCCC / _


Site Quality
7638.81
Filter Status
PASS
Note: These are site-level quality metrics: they may be unpredictable for multi-allelic sites.

Population Frequencies
Population Allele Count Allele Number Number of Homozygotes Number of Heterozygotes Homozygous Genotype Freq. Heterozygous Genotype Freq. Allele Frequency
Arab 3 204 0 3 0.0 0.0294 0.01471
Azeri 4 200 0 4 0.0 0.04 0.02
Baloch 4 202 0 4 0.0 0.0396 0.0198
Gilaki 1 198 0 1 0.0 0.0101 0.005051
Kurd 5 200 0 5 0.0 0.05 0.025
Lur 3 200 1 1 0.01 0.01 0.015
Mazani 1 200 0 1 0.0 0.01 0.005
Persian 3 200 0 3 0.0 0.03 0.015
Persian Gulf Islander 3 200 0 3 0.0 0.03 0.015
Sistani 11 200 1 9 0.01 0.09 0.055
Turkmen 0 200 0 0 0.0 0.0 0
Zartoshti 3 200 0 3 0.0 0.03 0.015
Total 41 2404 2 37 0.0016638935108153079 0.030782029950083195 0.01705
Annotations

This variant falls on 7 transcripts in 1 genes:

Note: This list may not include additional transcripts in the same gene that the variant does not overlap.

Additional Annotations
Metric Prediction
SIFT Pred (C) ?
Polyphen2 HVAR Pred (C) ?
MutationTaster Pred (C) ?
MutationAssessor Pred (C) ?
FATHMM Pred (C) ?
FATHMM MKL Coding Pred (C) ?
N of 6 Predicted Damaging ?
N of 6 Predicted Tolerated ?
MetaSVM Pred ?
MetaLR Pred ?
GERP++ RS ?
CADD Score (Phred Scale) 4.805
Ada Score ?
RF Score ?
PDIVAS Score ?
ConSplice Score ?
REVEL Score ?

Quality Metrics

Note: Plot may include low-quality genotypes that were excluded from allele counts in the table above