12:21610746 _ / TCCAGTCACCTCCCACCAGGCCGTACC

dbSNP
rs71444124
Allele Frequency
0.01248
Allele Count
30 / 2404
UCSC
12-21610746-_-TCCAGTCACCTCCCACCAGGCCGTACC
ClinVar
Click to search for variant in Clinvar
Ensembl
Click to search for variant in Ensembl
gnomAD Browser
Click to search for variant in gnomAD Browser
Site Quality
984.69
Filter Status
PASS
 Note: These are site-level quality metrics: they may be unpredictable for multi-allelic sites.
Population Frequencies
Population Allele Count Allele Number Number of Homozygotes Number of Heterozygotes Homozygous Genotype Freq. Heterozygous Genotype Freq. Allele Frequency
Arab 4 204 2 0 0.0196 0.0 0.01961
Azeri 0 200 0 0 0.0 0.0 0
Baloch 4 202 2 0 0.0198 0.0 0.0198
Gilaki 0 198 0 0 0.0 0.0 0
Kurd 2 200 1 0 0.01 0.0 0.01
Lur 0 200 0 0 0.0 0.0 0
Mazani 8 200 4 0 0.04 0.0 0.04
Persian 2 200 1 0 0.01 0.0 0.01
Persian Gulf Islander 2 200 1 0 0.01 0.0 0.01
Sistani 2 200 1 0 0.01 0.0 0.01
Turkmen 0 200 0 0 0.0 0.0 0
Zartoshti 6 200 3 0 0.03 0.0 0.03
Total 30 2404 15 0 0.012479201331114808 0.0 0.01248
Annotations

This variant falls on 7 transcripts in 1 genes:

Note: This list may not include additional transcripts in the same gene that the variant does not overlap.

Additional Annotations
Metric Prediction
SIFT Pred (C) ?
Polyphen2 HVAR Pred (C) ?
MutationTaster Pred (C) ?
MutationAssessor Pred (C) ?
FATHMM Pred (C) ?
FATHMM MKL Coding Pred (C) ?
N of 6 Predicted Damaging ?
N of 6 Predicted Tolerated ?
MetaSVM Pred ?
MetaLR Pred ?
GERP++ RS ?
CADD Score (Phred Scale) 1.345
Ada Score ?
RF Score ?
PDIVAS Score ?
ConSplice Score ?
REVEL Score ?

Quality Metrics

Note: Plot may include low-quality genotypes that were excluded from allele counts in the table above